ID: 1189855800

View in Genome Browser
Species Human (GRCh38)
Location X:45223872-45223894
Sequence GTGGTGTCAGAGAGGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189855800_1189855819 8 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855819 X:45223903-45223925 GTGGGGGGTTGCGGGGAGGTTGG No data
1189855800_1189855821 10 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855821 X:45223905-45223927 GGGGGGTTGCGGGGAGGTTGGGG No data
1189855800_1189855808 -9 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855808 X:45223886-45223908 TGACACCACCCCGGTGGGTGGGG No data
1189855800_1189855818 4 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855818 X:45223899-45223921 GTGGGTGGGGGGTTGCGGGGAGG No data
1189855800_1189855807 -10 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855807 X:45223885-45223907 CTGACACCACCCCGGTGGGTGGG No data
1189855800_1189855809 -8 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855809 X:45223887-45223909 GACACCACCCCGGTGGGTGGGGG No data
1189855800_1189855823 28 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855823 X:45223923-45223945 TGGGGTGCCTCGTTATGGCCTGG No data
1189855800_1189855817 1 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855817 X:45223896-45223918 CCGGTGGGTGGGGGGTTGCGGGG No data
1189855800_1189855813 -1 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855813 X:45223894-45223916 CCCCGGTGGGTGGGGGGTTGCGG No data
1189855800_1189855815 0 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855815 X:45223895-45223917 CCCGGTGGGTGGGGGGTTGCGGG No data
1189855800_1189855822 23 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855822 X:45223918-45223940 GAGGTTGGGGTGCCTCGTTATGG No data
1189855800_1189855820 9 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855820 X:45223904-45223926 TGGGGGGTTGCGGGGAGGTTGGG No data
1189855800_1189855810 -7 Left 1189855800 X:45223872-45223894 CCCAGTAACCTCTCTGACACCAC No data
Right 1189855810 X:45223888-45223910 ACACCACCCCGGTGGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189855800 Original CRISPR GTGGTGTCAGAGAGGTTACT GGG (reversed) Intergenic
No off target data available for this crispr