ID: 1189860057

View in Genome Browser
Species Human (GRCh38)
Location X:45262817-45262839
Sequence AAGACCATGGAGAGGTATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189860053_1189860057 10 Left 1189860053 X:45262784-45262806 CCCTAACTAGCTCATGCAGACAG No data
Right 1189860057 X:45262817-45262839 AAGACCATGGAGAGGTATTCTGG No data
1189860054_1189860057 9 Left 1189860054 X:45262785-45262807 CCTAACTAGCTCATGCAGACAGA No data
Right 1189860057 X:45262817-45262839 AAGACCATGGAGAGGTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189860057 Original CRISPR AAGACCATGGAGAGGTATTC TGG Intergenic
No off target data available for this crispr