ID: 1189863856

View in Genome Browser
Species Human (GRCh38)
Location X:45302354-45302376
Sequence GTTTCTCCCAAAAAGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189863856_1189863863 21 Left 1189863856 X:45302354-45302376 CCAAACTCCTTTTTGGGAGAAAC No data
Right 1189863863 X:45302398-45302420 CCCAAGAGTGTAAACAGACAAGG No data
1189863856_1189863858 -5 Left 1189863856 X:45302354-45302376 CCAAACTCCTTTTTGGGAGAAAC No data
Right 1189863858 X:45302372-45302394 GAAACCTCTGTTTTTCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189863856 Original CRISPR GTTTCTCCCAAAAAGGAGTT TGG (reversed) Intergenic
No off target data available for this crispr