ID: 1189865590

View in Genome Browser
Species Human (GRCh38)
Location X:45323805-45323827
Sequence AAGAGTGGGAAGGGTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189865590_1189865601 7 Left 1189865590 X:45323805-45323827 CCATCCCCACCCTTCCCACTCTT No data
Right 1189865601 X:45323835-45323857 TGGACCATCGGCCACATAAAGGG No data
1189865590_1189865600 6 Left 1189865590 X:45323805-45323827 CCATCCCCACCCTTCCCACTCTT No data
Right 1189865600 X:45323834-45323856 GTGGACCATCGGCCACATAAAGG No data
1189865590_1189865599 -5 Left 1189865590 X:45323805-45323827 CCATCCCCACCCTTCCCACTCTT No data
Right 1189865599 X:45323823-45323845 CTCTTCTACAAGTGGACCATCGG No data
1189865590_1189865604 29 Left 1189865590 X:45323805-45323827 CCATCCCCACCCTTCCCACTCTT No data
Right 1189865604 X:45323857-45323879 GCCATATGCCACACTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189865590 Original CRISPR AAGAGTGGGAAGGGTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr