ID: 1189868878

View in Genome Browser
Species Human (GRCh38)
Location X:45361067-45361089
Sequence GATGAGTCCTAGTACTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189868878_1189868882 22 Left 1189868878 X:45361067-45361089 CCAGGTCAGTACTAGGACTCATC No data
Right 1189868882 X:45361112-45361134 CTAGACAGCTTTTCAAGTTTAGG No data
1189868878_1189868879 -2 Left 1189868878 X:45361067-45361089 CCAGGTCAGTACTAGGACTCATC No data
Right 1189868879 X:45361088-45361110 TCTAAGATTTGCAGTCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189868878 Original CRISPR GATGAGTCCTAGTACTGACC TGG (reversed) Intergenic
No off target data available for this crispr