ID: 1189869037

View in Genome Browser
Species Human (GRCh38)
Location X:45362898-45362920
Sequence TCTTATTTTGGCAAGGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189869037_1189869042 9 Left 1189869037 X:45362898-45362920 CCATAAACCTTGCCAAAATAAGA No data
Right 1189869042 X:45362930-45362952 TTTTCTCAATGGGCAACTCAAGG No data
1189869037_1189869040 -2 Left 1189869037 X:45362898-45362920 CCATAAACCTTGCCAAAATAAGA No data
Right 1189869040 X:45362919-45362941 GAATTATGCAGTTTTCTCAATGG No data
1189869037_1189869041 -1 Left 1189869037 X:45362898-45362920 CCATAAACCTTGCCAAAATAAGA No data
Right 1189869041 X:45362920-45362942 AATTATGCAGTTTTCTCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189869037 Original CRISPR TCTTATTTTGGCAAGGTTTA TGG (reversed) Intergenic
No off target data available for this crispr