ID: 1189871617

View in Genome Browser
Species Human (GRCh38)
Location X:45389895-45389917
Sequence ATTCAATCCTTTACTTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189871615_1189871617 14 Left 1189871615 X:45389858-45389880 CCTGGGCTTTTCTTTGATGGGAG 0: 62
1: 326
2: 841
3: 1230
4: 2443
Right 1189871617 X:45389895-45389917 ATTCAATCCTTTACTTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189871617 Original CRISPR ATTCAATCCTTTACTTATGT TGG Intergenic
No off target data available for this crispr