ID: 1189871942

View in Genome Browser
Species Human (GRCh38)
Location X:45393492-45393514
Sequence ACTTTTGCACCAGTGTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189871942_1189871954 29 Left 1189871942 X:45393492-45393514 CCAGAGCACACTGGTGCAAAAGT No data
Right 1189871954 X:45393544-45393566 TCTGTGGCTTTGCAGGGTTAAGG No data
1189871942_1189871947 -4 Left 1189871942 X:45393492-45393514 CCAGAGCACACTGGTGCAAAAGT No data
Right 1189871947 X:45393511-45393533 AAGTGGGTTCCCAAGGTCTTGGG No data
1189871942_1189871950 13 Left 1189871942 X:45393492-45393514 CCAGAGCACACTGGTGCAAAAGT No data
Right 1189871950 X:45393528-45393550 CTTGGGAAGCTCTTCCTCTGTGG No data
1189871942_1189871952 23 Left 1189871942 X:45393492-45393514 CCAGAGCACACTGGTGCAAAAGT No data
Right 1189871952 X:45393538-45393560 TCTTCCTCTGTGGCTTTGCAGGG No data
1189871942_1189871946 -5 Left 1189871942 X:45393492-45393514 CCAGAGCACACTGGTGCAAAAGT No data
Right 1189871946 X:45393510-45393532 AAAGTGGGTTCCCAAGGTCTTGG No data
1189871942_1189871951 22 Left 1189871942 X:45393492-45393514 CCAGAGCACACTGGTGCAAAAGT No data
Right 1189871951 X:45393537-45393559 CTCTTCCTCTGTGGCTTTGCAGG 0: 9
1: 156
2: 879
3: 1668
4: 2172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189871942 Original CRISPR ACTTTTGCACCAGTGTGCTC TGG (reversed) Intergenic
No off target data available for this crispr