ID: 1189872161

View in Genome Browser
Species Human (GRCh38)
Location X:45395227-45395249
Sequence AAATATGCTGATAGTCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189872159_1189872161 9 Left 1189872159 X:45395195-45395217 CCATATCACTGTCCTGCAGTGTT No data
Right 1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG No data
1189872158_1189872161 13 Left 1189872158 X:45395191-45395213 CCAACCATATCACTGTCCTGCAG No data
Right 1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG No data
1189872160_1189872161 -3 Left 1189872160 X:45395207-45395229 CCTGCAGTGTTTCTGCTGAGAAA No data
Right 1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189872161 Original CRISPR AAATATGCTGATAGTCATAT TGG Intergenic
No off target data available for this crispr