ID: 1189874593 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:45422524-45422546 |
| Sequence | TCTGATATCCAGAATGTATA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1189874590_1189874593 | 24 | Left | 1189874590 | X:45422477-45422499 | CCTACATAATGGGAGAAAATATT | 0: 48 1: 2793 2: 20118 3: 14621 4: 7905 |
||
| Right | 1189874593 | X:45422524-45422546 | TCTGATATCCAGAATGTATAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1189874593 | Original CRISPR | TCTGATATCCAGAATGTATA AGG | Intergenic | ||
| No off target data available for this crispr | |||||