ID: 1189874593

View in Genome Browser
Species Human (GRCh38)
Location X:45422524-45422546
Sequence TCTGATATCCAGAATGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189874590_1189874593 24 Left 1189874590 X:45422477-45422499 CCTACATAATGGGAGAAAATATT 0: 48
1: 2793
2: 20118
3: 14621
4: 7905
Right 1189874593 X:45422524-45422546 TCTGATATCCAGAATGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189874593 Original CRISPR TCTGATATCCAGAATGTATA AGG Intergenic
No off target data available for this crispr