ID: 1189876596

View in Genome Browser
Species Human (GRCh38)
Location X:45442561-45442583
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189876596_1189876600 9 Left 1189876596 X:45442561-45442583 CCTATATAATTGTAGCTTTGTAC No data
Right 1189876600 X:45442593-45442615 AAACTCTCCTTATCTACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189876596 Original CRISPR GTACAAAGCTACAATTATAT AGG (reversed) Intergenic
No off target data available for this crispr