ID: 1189886007

View in Genome Browser
Species Human (GRCh38)
Location X:45545710-45545732
Sequence CCCACCAGGCCCCACCCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189886001_1189886007 -3 Left 1189886001 X:45545690-45545712 CCCTCAGGATCTAAACACCTCCC No data
Right 1189886007 X:45545710-45545732 CCCACCAGGCCCCACCCATTGGG No data
1189886002_1189886007 -4 Left 1189886002 X:45545691-45545713 CCTCAGGATCTAAACACCTCCCA No data
Right 1189886007 X:45545710-45545732 CCCACCAGGCCCCACCCATTGGG No data
1189885999_1189886007 16 Left 1189885999 X:45545671-45545693 CCAAGCTATGAGGGATAAGCCCT No data
Right 1189886007 X:45545710-45545732 CCCACCAGGCCCCACCCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189886007 Original CRISPR CCCACCAGGCCCCACCCATT GGG Intergenic
No off target data available for this crispr