ID: 1189890542

View in Genome Browser
Species Human (GRCh38)
Location X:45597555-45597577
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189890542_1189890547 8 Left 1189890542 X:45597555-45597577 CCCTGAAGGTGGTAACACTGAAG No data
Right 1189890547 X:45597586-45597608 CCCTTAGCACTCCCAGCAGCTGG No data
1189890542_1189890549 9 Left 1189890542 X:45597555-45597577 CCCTGAAGGTGGTAACACTGAAG No data
Right 1189890549 X:45597587-45597609 CCTTAGCACTCCCAGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189890542 Original CRISPR CTTCAGTGTTACCACCTTCA GGG (reversed) Intergenic
No off target data available for this crispr