ID: 1189892018

View in Genome Browser
Species Human (GRCh38)
Location X:45612758-45612780
Sequence GACCAGTACTTACAAGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189892006_1189892018 18 Left 1189892006 X:45612717-45612739 CCACACCAGCACCAGGCCAGCCC No data
Right 1189892018 X:45612758-45612780 GACCAGTACTTACAAGCACATGG No data
1189892004_1189892018 24 Left 1189892004 X:45612711-45612733 CCAGGCCCACACCAGCACCAGGC No data
Right 1189892018 X:45612758-45612780 GACCAGTACTTACAAGCACATGG No data
1189892012_1189892018 -4 Left 1189892012 X:45612739-45612761 CCTGCTGCCCCAGCCACCAGACC No data
Right 1189892018 X:45612758-45612780 GACCAGTACTTACAAGCACATGG No data
1189892008_1189892018 7 Left 1189892008 X:45612728-45612750 CCAGGCCAGCCCCTGCTGCCCCA No data
Right 1189892018 X:45612758-45612780 GACCAGTACTTACAAGCACATGG No data
1189892005_1189892018 19 Left 1189892005 X:45612716-45612738 CCCACACCAGCACCAGGCCAGCC No data
Right 1189892018 X:45612758-45612780 GACCAGTACTTACAAGCACATGG No data
1189892007_1189892018 13 Left 1189892007 X:45612722-45612744 CCAGCACCAGGCCAGCCCCTGCT No data
Right 1189892018 X:45612758-45612780 GACCAGTACTTACAAGCACATGG No data
1189892011_1189892018 -3 Left 1189892011 X:45612738-45612760 CCCTGCTGCCCCAGCCACCAGAC No data
Right 1189892018 X:45612758-45612780 GACCAGTACTTACAAGCACATGG No data
1189892010_1189892018 -2 Left 1189892010 X:45612737-45612759 CCCCTGCTGCCCCAGCCACCAGA No data
Right 1189892018 X:45612758-45612780 GACCAGTACTTACAAGCACATGG No data
1189892009_1189892018 2 Left 1189892009 X:45612733-45612755 CCAGCCCCTGCTGCCCCAGCCAC No data
Right 1189892018 X:45612758-45612780 GACCAGTACTTACAAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189892018 Original CRISPR GACCAGTACTTACAAGCACA TGG Intergenic
No off target data available for this crispr