ID: 1189893782

View in Genome Browser
Species Human (GRCh38)
Location X:45632671-45632693
Sequence CAGCTCGGACAACTTGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 5, 2: 7, 3: 20, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189893777_1189893782 -5 Left 1189893777 X:45632653-45632675 CCGCTGCAGAACGGCCTCCAGCT 0: 1
1: 0
2: 12
3: 22
4: 175
Right 1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG 0: 1
1: 5
2: 7
3: 20
4: 110
1189893774_1189893782 5 Left 1189893774 X:45632643-45632665 CCTGCTTGGCCCGCTGCAGAACG 0: 1
1: 0
2: 8
3: 17
4: 68
Right 1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG 0: 1
1: 5
2: 7
3: 20
4: 110
1189893772_1189893782 16 Left 1189893772 X:45632632-45632654 CCGCGCCATGTCCTGCTTGGCCC 0: 6
1: 7
2: 14
3: 32
4: 182
Right 1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG 0: 1
1: 5
2: 7
3: 20
4: 110
1189893776_1189893782 -4 Left 1189893776 X:45632652-45632674 CCCGCTGCAGAACGGCCTCCAGC 0: 1
1: 0
2: 12
3: 41
4: 218
Right 1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG 0: 1
1: 5
2: 7
3: 20
4: 110
1189893773_1189893782 11 Left 1189893773 X:45632637-45632659 CCATGTCCTGCTTGGCCCGCTGC 0: 13
1: 9
2: 21
3: 34
4: 222
Right 1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG 0: 1
1: 5
2: 7
3: 20
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189893782 Original CRISPR CAGCTCGGACAACTTGGCCT TGG Intergenic
904673132 1:32180589-32180611 CCTCCCGGACAACCTGGCCTCGG - Intronic
904793742 1:33043406-33043428 CAGCCTGGGCAACATGGCCTGGG + Intronic
904937562 1:34142311-34142333 CAAATCAGACAACTTGTCCTTGG + Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
908845973 1:68324536-68324558 CCTCTTGGACAACTTGCCCTGGG - Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
910441317 1:87255239-87255261 CTGCTAGGAAAACATGGCCTTGG + Intergenic
912746354 1:112248638-112248660 CAGCTCAGACAGTTCGGCCTGGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
918111309 1:181457559-181457581 CAGCTCGGACAACTTCTGCAGGG + Intronic
923211602 1:231808654-231808676 CAGGTCAGACAACTAGGCATTGG - Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1069639190 10:69944014-69944036 CAACTCTGAAAACTGGGCCTTGG + Intronic
1069832174 10:71288061-71288083 GAGCTCTGAAACCTTGGCCTGGG - Intronic
1069833028 10:71292500-71292522 CATCTCGTAGAACTTGCCCTGGG - Exonic
1070585581 10:77763533-77763555 CACTTCGGAAAACTTGCCCTAGG + Intergenic
1071566212 10:86672704-86672726 CAGCCCGGAGGACCTGGCCTGGG - Intronic
1074352929 10:112755824-112755846 CAGCTAAGACAGGTTGGCCTAGG + Intronic
1077047287 11:552176-552198 CAGCTCTGACTTCCTGGCCTTGG + Exonic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078203331 11:9204533-9204555 CAGCACAGACAACTCAGCCTGGG + Intronic
1085047631 11:73362747-73362769 CATCTCCTCCAACTTGGCCTTGG + Intronic
1087905240 11:103688303-103688325 CAGCAAGGACAAGATGGCCTGGG + Intergenic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1092755480 12:11759272-11759294 CAGCTCTGACAAAGTGGCCCTGG + Intronic
1094690337 12:32762230-32762252 CAGTCCCGACAACATGGCCTGGG - Intergenic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096574868 12:52546420-52546442 CAGCTCGTCCAGCTTGGCCCGGG + Exonic
1096578273 12:52568303-52568325 CAGCTCATCCAGCTTGGCCTGGG + Exonic
1096603399 12:52746721-52746743 GAGCTCTGCCAACTTGGCCTGGG + Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1113827090 13:113264209-113264231 CAGGGCGGACACCATGGCCTTGG - Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1117536033 14:56704208-56704230 CCACTCGGAGAACTGGGCCTTGG + Intronic
1121903992 14:97723271-97723293 CAGGTCGGACAAAATGGTCTGGG + Intergenic
1121945394 14:98116250-98116272 CAGCTCCCATAACTTCGCCTGGG + Intergenic
1124341900 15:28895162-28895184 CAGCTCCGCCAACTTACCCTCGG + Intronic
1124664040 15:31576506-31576528 AAGGTGGGACAACTTGACCTGGG - Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126097864 15:45101935-45101957 CACCTCGGCCAGCTGGGCCTTGG + Exonic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1126877533 15:53060419-53060441 CAGTTCTGACCACTTGGCCTCGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1131548476 15:93335633-93335655 CAGCACTGACCATTTGGCCTAGG + Intergenic
1131832832 15:96365361-96365383 CAGGGAGGACAACTTGGCCCTGG + Intergenic
1132338289 15:101062787-101062809 CACCTAGGACCACCTGGCCTAGG + Intronic
1132761467 16:1510506-1510528 CAGCTGGGACACCCGGGCCTTGG - Exonic
1132881220 16:2162529-2162551 CAGCTCCGCCACTTTGGCCTGGG + Intronic
1133244304 16:4437448-4437470 CAGCTGGGAGAACTTCTCCTTGG - Exonic
1137726718 16:50661617-50661639 CAGCTAGAAAAACTTGGCTTTGG + Intergenic
1137959040 16:52862917-52862939 CAGTTCTGACCACTTGGACTGGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1144585182 17:16483351-16483373 CAGCACAGACAGGTTGGCCTCGG + Intronic
1144677413 17:17170853-17170875 CAGCTCTGATAACCAGGCCTGGG + Intronic
1146328663 17:31909278-31909300 CAGCTCGGCCAACATGGTCATGG - Intergenic
1148861108 17:50604732-50604754 CTGCTGGGGAAACTTGGCCTTGG + Intronic
1149756492 17:59190807-59190829 CAGCCAAGAGAACTTGGCCTGGG + Intronic
1155304863 18:24469177-24469199 CAGTTGGGACAACTTGCCTTGGG - Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1160675834 19:390843-390865 CCTCTCAGACCACTTGGCCTTGG - Intergenic
1160891983 19:1383916-1383938 CAGCACCGCCATCTTGGCCTCGG - Exonic
1167241363 19:48345217-48345239 CAGCGGGGAGAAGTTGGCCTGGG + Exonic
931252878 2:60549683-60549705 CAGCTCGGCCAGCTCGGCCGCGG + Intronic
932224968 2:70032323-70032345 CTGCTCAGACACCTTGGCTTAGG + Intergenic
938758814 2:134405203-134405225 AAACTTGGACATCTTGGCCTGGG - Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
1171992190 20:31705072-31705094 CAGGTAGGACAAGTTGGCTTTGG + Intronic
1173807970 20:45938671-45938693 GAGCTCTGACCACCTGGCCTGGG + Intronic
1174417432 20:50376861-50376883 CTGCTGGGACACCATGGCCTGGG - Intergenic
1175440811 20:58989895-58989917 CAGCACGGACATCATGGCCTGGG - Exonic
1181960527 22:26618920-26618942 CAGGTCAGATAACGTGGCCTGGG - Intergenic
1184452475 22:44591296-44591318 CAGCCCGGACTTCTAGGCCTGGG + Intergenic
950264417 3:11563619-11563641 CAGCAGTGATAACTTGGCCTCGG + Intronic
950424754 3:12919125-12919147 CTGCTTGGACACCTGGGCCTGGG + Intronic
952327837 3:32336933-32336955 CAGCTATGACCCCTTGGCCTTGG - Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953734066 3:45476336-45476358 CAGCTCTGACCACTGGGCCAGGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
958429920 3:94026898-94026920 CAACTTGGACAACTTGTTCTGGG + Intronic
959984231 3:112555796-112555818 CAGCTGGGCTAATTTGGCCTTGG + Intronic
961235154 3:125359954-125359976 CAGCTGGCACAACTGGGCCTGGG + Intronic
961911218 3:130318434-130318456 CATCTGGGAAAACTTGACCTTGG + Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
963939885 3:151087080-151087102 CCGCTGGGCCAACTTGGCCCCGG - Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
982162228 4:152581676-152581698 CAGCTAGCACAACTAGGGCTTGG + Intergenic
984375328 4:178922298-178922320 CAGAACTGACAACTTGGCCCTGG - Intergenic
984924861 4:184797744-184797766 CCGCTCGGACCCCTTGTCCTTGG - Intronic
987234365 5:15928188-15928210 CCGCTGGTACAACCTGGCCTGGG + Exonic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997386795 5:133480102-133480124 CAGCAGGGTCAACTTCGCCTGGG - Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
999205827 5:149847269-149847291 CTGCTGGGACATCTTGGCCATGG - Intronic
1001968951 5:175938339-175938361 CAGAGTGGACCACTTGGCCTGGG - Intronic
1002248493 5:177905406-177905428 CAGAGTGGACCACTTGGCCTGGG + Intergenic
1002709880 5:181189041-181189063 CAGCGGGGACAAGTTGGGCTTGG - Intergenic
1003597063 6:7482870-7482892 CAGCCTGGCCAACATGGCCTTGG + Intergenic
1004433096 6:15564043-15564065 CAGCCTGGGCAACTTGGTCTCGG + Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1015998348 6:139017419-139017441 CAGCACTGACCATTTGGCCTAGG + Intergenic
1016670772 6:146704378-146704400 AAGCTCCAAGAACTTGGCCTGGG - Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019573778 7:1726472-1726494 GAGCTGGGCCAGCTTGGCCTTGG - Intronic
1022189116 7:27999798-27999820 CAGCTCAGACAGCTCTGCCTTGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1025253207 7:57365675-57365697 CTGCTGGGACACCATGGCCTGGG + Intergenic
1026765559 7:73157313-73157335 CAGCTGGGTCACCTGGGCCTGGG - Intergenic
1027042032 7:74967006-74967028 CAGCTGGGTCACCTGGGCCTGGG - Intronic
1027081609 7:75235348-75235370 CAGCTGGGTCACCTGGGCCTGGG + Intergenic
1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG + Exonic
1028754832 7:94423025-94423047 CAGTTCGGCCAACTGGACCTTGG - Exonic
1029381372 7:100217344-100217366 CAGCTCGTCCAGCCTGGCCTGGG - Intronic
1029390194 7:100269929-100269951 CAGCTGGGTCACCTGGGCCTGGG + Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1033220769 7:139525021-139525043 TAGCTCTGACCACCTGGCCTGGG - Intronic
1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG + Intronic
1036553041 8:9831998-9832020 CAGCTAGGGCAAATTGTCCTTGG + Intergenic
1038406102 8:27324205-27324227 CAGGTGGGAGAACTTGGCCAGGG - Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1043879672 8:85528082-85528104 CACTTCAAACAACTTGGCCTGGG + Intergenic
1047225429 8:122952373-122952395 CAGCCAGGACAACTCAGCCTGGG - Exonic
1048870035 8:138789766-138789788 CAGCTCTGTCACCTTGGCCATGG + Intronic
1049378452 8:142300618-142300640 CAGCTCGGCAAACGGGGCCTGGG + Exonic
1049798343 8:144506532-144506554 CTGCTCGGTGAGCTTGGCCTTGG - Exonic
1050276987 9:4010268-4010290 CAGGTCGAATAACTTGGCCAAGG - Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1060027390 9:120184762-120184784 CACCTTGGACAACTTGCCTTTGG - Intergenic
1062419720 9:136474373-136474395 CAGCTCCGAAAACATGGCTTTGG + Exonic
1062507022 9:136882749-136882771 AAGCTGTGACACCTTGGCCTGGG - Intronic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1194510081 X:94783206-94783228 CAGGTCTGAGAACTTGCCCTAGG - Intergenic