ID: 1189898978

View in Genome Browser
Species Human (GRCh38)
Location X:45686348-45686370
Sequence CCTCTGTGGCATAGAAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189898978_1189898983 10 Left 1189898978 X:45686348-45686370 CCAAAGCTTCTATGCCACAGAGG No data
Right 1189898983 X:45686381-45686403 TTCCCAAAGTGGGTGTTGAGTGG No data
1189898978_1189898981 -1 Left 1189898978 X:45686348-45686370 CCAAAGCTTCTATGCCACAGAGG No data
Right 1189898981 X:45686370-45686392 GCAAATCAGCATTCCCAAAGTGG No data
1189898978_1189898984 11 Left 1189898978 X:45686348-45686370 CCAAAGCTTCTATGCCACAGAGG No data
Right 1189898984 X:45686382-45686404 TCCCAAAGTGGGTGTTGAGTGGG No data
1189898978_1189898986 12 Left 1189898978 X:45686348-45686370 CCAAAGCTTCTATGCCACAGAGG No data
Right 1189898986 X:45686383-45686405 CCCAAAGTGGGTGTTGAGTGGGG No data
1189898978_1189898982 0 Left 1189898978 X:45686348-45686370 CCAAAGCTTCTATGCCACAGAGG No data
Right 1189898982 X:45686371-45686393 CAAATCAGCATTCCCAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189898978 Original CRISPR CCTCTGTGGCATAGAAGCTT TGG (reversed) Intergenic
No off target data available for this crispr