ID: 1189898982

View in Genome Browser
Species Human (GRCh38)
Location X:45686371-45686393
Sequence CAAATCAGCATTCCCAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189898978_1189898982 0 Left 1189898978 X:45686348-45686370 CCAAAGCTTCTATGCCACAGAGG No data
Right 1189898982 X:45686371-45686393 CAAATCAGCATTCCCAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189898982 Original CRISPR CAAATCAGCATTCCCAAAGT GGG Intergenic
No off target data available for this crispr