ID: 1189898983

View in Genome Browser
Species Human (GRCh38)
Location X:45686381-45686403
Sequence TTCCCAAAGTGGGTGTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189898978_1189898983 10 Left 1189898978 X:45686348-45686370 CCAAAGCTTCTATGCCACAGAGG No data
Right 1189898983 X:45686381-45686403 TTCCCAAAGTGGGTGTTGAGTGG No data
1189898980_1189898983 -4 Left 1189898980 X:45686362-45686384 CCACAGAGGCAAATCAGCATTCC No data
Right 1189898983 X:45686381-45686403 TTCCCAAAGTGGGTGTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189898983 Original CRISPR TTCCCAAAGTGGGTGTTGAG TGG Intergenic
No off target data available for this crispr