ID: 1189900355

View in Genome Browser
Species Human (GRCh38)
Location X:45700123-45700145
Sequence GACTCTTAAGCAGGCCGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189900355_1189900363 27 Left 1189900355 X:45700123-45700145 CCTTAACGGCCTGCTTAAGAGTC No data
Right 1189900363 X:45700173-45700195 CAGTGGATAAGGAAAGAGGGTGG No data
1189900355_1189900359 10 Left 1189900355 X:45700123-45700145 CCTTAACGGCCTGCTTAAGAGTC No data
Right 1189900359 X:45700156-45700178 CCAGTATGACTGGAGCACAGTGG No data
1189900355_1189900362 24 Left 1189900355 X:45700123-45700145 CCTTAACGGCCTGCTTAAGAGTC No data
Right 1189900362 X:45700170-45700192 GCACAGTGGATAAGGAAAGAGGG No data
1189900355_1189900360 16 Left 1189900355 X:45700123-45700145 CCTTAACGGCCTGCTTAAGAGTC No data
Right 1189900360 X:45700162-45700184 TGACTGGAGCACAGTGGATAAGG No data
1189900355_1189900357 0 Left 1189900355 X:45700123-45700145 CCTTAACGGCCTGCTTAAGAGTC No data
Right 1189900357 X:45700146-45700168 AGAAAGAAAGCCAGTATGACTGG No data
1189900355_1189900361 23 Left 1189900355 X:45700123-45700145 CCTTAACGGCCTGCTTAAGAGTC No data
Right 1189900361 X:45700169-45700191 AGCACAGTGGATAAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189900355 Original CRISPR GACTCTTAAGCAGGCCGTTA AGG (reversed) Intergenic
No off target data available for this crispr