ID: 1189900357

View in Genome Browser
Species Human (GRCh38)
Location X:45700146-45700168
Sequence AGAAAGAAAGCCAGTATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189900354_1189900357 1 Left 1189900354 X:45700122-45700144 CCCTTAACGGCCTGCTTAAGAGT No data
Right 1189900357 X:45700146-45700168 AGAAAGAAAGCCAGTATGACTGG No data
1189900356_1189900357 -9 Left 1189900356 X:45700132-45700154 CCTGCTTAAGAGTCAGAAAGAAA No data
Right 1189900357 X:45700146-45700168 AGAAAGAAAGCCAGTATGACTGG No data
1189900355_1189900357 0 Left 1189900355 X:45700123-45700145 CCTTAACGGCCTGCTTAAGAGTC No data
Right 1189900357 X:45700146-45700168 AGAAAGAAAGCCAGTATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189900357 Original CRISPR AGAAAGAAAGCCAGTATGAC TGG Intergenic
No off target data available for this crispr