ID: 1189900358

View in Genome Browser
Species Human (GRCh38)
Location X:45700156-45700178
Sequence CCACTGTGCTCCAGTCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189900358_1189900368 25 Left 1189900358 X:45700156-45700178 CCAGTATGACTGGAGCACAGTGG No data
Right 1189900368 X:45700204-45700226 AAGGCTGAAGAAGTAGGCAGGGG No data
1189900358_1189900362 -9 Left 1189900358 X:45700156-45700178 CCAGTATGACTGGAGCACAGTGG No data
Right 1189900362 X:45700170-45700192 GCACAGTGGATAAGGAAAGAGGG No data
1189900358_1189900367 24 Left 1189900358 X:45700156-45700178 CCAGTATGACTGGAGCACAGTGG No data
Right 1189900367 X:45700203-45700225 TAAGGCTGAAGAAGTAGGCAGGG No data
1189900358_1189900366 23 Left 1189900358 X:45700156-45700178 CCAGTATGACTGGAGCACAGTGG No data
Right 1189900366 X:45700202-45700224 ATAAGGCTGAAGAAGTAGGCAGG No data
1189900358_1189900365 19 Left 1189900358 X:45700156-45700178 CCAGTATGACTGGAGCACAGTGG No data
Right 1189900365 X:45700198-45700220 GAATATAAGGCTGAAGAAGTAGG No data
1189900358_1189900364 6 Left 1189900358 X:45700156-45700178 CCAGTATGACTGGAGCACAGTGG No data
Right 1189900364 X:45700185-45700207 AAAGAGGGTGGTAGAATATAAGG No data
1189900358_1189900363 -6 Left 1189900358 X:45700156-45700178 CCAGTATGACTGGAGCACAGTGG No data
Right 1189900363 X:45700173-45700195 CAGTGGATAAGGAAAGAGGGTGG No data
1189900358_1189900361 -10 Left 1189900358 X:45700156-45700178 CCAGTATGACTGGAGCACAGTGG No data
Right 1189900361 X:45700169-45700191 AGCACAGTGGATAAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189900358 Original CRISPR CCACTGTGCTCCAGTCATAC TGG (reversed) Intergenic
No off target data available for this crispr