ID: 1189900361

View in Genome Browser
Species Human (GRCh38)
Location X:45700169-45700191
Sequence AGCACAGTGGATAAGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189900356_1189900361 14 Left 1189900356 X:45700132-45700154 CCTGCTTAAGAGTCAGAAAGAAA No data
Right 1189900361 X:45700169-45700191 AGCACAGTGGATAAGGAAAGAGG No data
1189900354_1189900361 24 Left 1189900354 X:45700122-45700144 CCCTTAACGGCCTGCTTAAGAGT No data
Right 1189900361 X:45700169-45700191 AGCACAGTGGATAAGGAAAGAGG No data
1189900358_1189900361 -10 Left 1189900358 X:45700156-45700178 CCAGTATGACTGGAGCACAGTGG No data
Right 1189900361 X:45700169-45700191 AGCACAGTGGATAAGGAAAGAGG No data
1189900355_1189900361 23 Left 1189900355 X:45700123-45700145 CCTTAACGGCCTGCTTAAGAGTC No data
Right 1189900361 X:45700169-45700191 AGCACAGTGGATAAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189900361 Original CRISPR AGCACAGTGGATAAGGAAAG AGG Intergenic
No off target data available for this crispr