ID: 1189904272

View in Genome Browser
Species Human (GRCh38)
Location X:45742003-45742025
Sequence CATTCTGATCATGATAACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189904272_1189904274 13 Left 1189904272 X:45742003-45742025 CCTAAGTTATCATGATCAGAATG No data
Right 1189904274 X:45742039-45742061 GCATAGTAAAGGCCATCGTGAGG No data
1189904272_1189904273 2 Left 1189904272 X:45742003-45742025 CCTAAGTTATCATGATCAGAATG No data
Right 1189904273 X:45742028-45742050 GACAGATATATGCATAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189904272 Original CRISPR CATTCTGATCATGATAACTT AGG (reversed) Intergenic
No off target data available for this crispr