ID: 1189904274

View in Genome Browser
Species Human (GRCh38)
Location X:45742039-45742061
Sequence GCATAGTAAAGGCCATCGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189904272_1189904274 13 Left 1189904272 X:45742003-45742025 CCTAAGTTATCATGATCAGAATG No data
Right 1189904274 X:45742039-45742061 GCATAGTAAAGGCCATCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189904274 Original CRISPR GCATAGTAAAGGCCATCGTG AGG Intergenic
No off target data available for this crispr