ID: 1189906928

View in Genome Browser
Species Human (GRCh38)
Location X:45770757-45770779
Sequence CAGGGGTATTTTGAGGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189906928_1189906935 -6 Left 1189906928 X:45770757-45770779 CCCATCCCCTCAAAATACCCCTG No data
Right 1189906935 X:45770774-45770796 CCCCTGAAGGAGATTCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189906928 Original CRISPR CAGGGGTATTTTGAGGGGAT GGG (reversed) Intergenic
No off target data available for this crispr