ID: 1189907488

View in Genome Browser
Species Human (GRCh38)
Location X:45776636-45776658
Sequence GAGTATTATTTCTACTACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189907488_1189907495 22 Left 1189907488 X:45776636-45776658 CCTATGTAGTAGAAATAATACTC No data
Right 1189907495 X:45776681-45776703 CTGACCAGCATCTATCGCAAGGG No data
1189907488_1189907496 23 Left 1189907488 X:45776636-45776658 CCTATGTAGTAGAAATAATACTC No data
Right 1189907496 X:45776682-45776704 TGACCAGCATCTATCGCAAGGGG No data
1189907488_1189907498 27 Left 1189907488 X:45776636-45776658 CCTATGTAGTAGAAATAATACTC No data
Right 1189907498 X:45776686-45776708 CAGCATCTATCGCAAGGGGCTGG No data
1189907488_1189907494 21 Left 1189907488 X:45776636-45776658 CCTATGTAGTAGAAATAATACTC No data
Right 1189907494 X:45776680-45776702 CCTGACCAGCATCTATCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189907488 Original CRISPR GAGTATTATTTCTACTACAT AGG (reversed) Intergenic
No off target data available for this crispr