ID: 1189907488 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:45776636-45776658 |
Sequence | GAGTATTATTTCTACTACAT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1189907488_1189907495 | 22 | Left | 1189907488 | X:45776636-45776658 | CCTATGTAGTAGAAATAATACTC | No data | ||
Right | 1189907495 | X:45776681-45776703 | CTGACCAGCATCTATCGCAAGGG | No data | ||||
1189907488_1189907496 | 23 | Left | 1189907488 | X:45776636-45776658 | CCTATGTAGTAGAAATAATACTC | No data | ||
Right | 1189907496 | X:45776682-45776704 | TGACCAGCATCTATCGCAAGGGG | No data | ||||
1189907488_1189907498 | 27 | Left | 1189907488 | X:45776636-45776658 | CCTATGTAGTAGAAATAATACTC | No data | ||
Right | 1189907498 | X:45776686-45776708 | CAGCATCTATCGCAAGGGGCTGG | No data | ||||
1189907488_1189907494 | 21 | Left | 1189907488 | X:45776636-45776658 | CCTATGTAGTAGAAATAATACTC | No data | ||
Right | 1189907494 | X:45776680-45776702 | CCTGACCAGCATCTATCGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1189907488 | Original CRISPR | GAGTATTATTTCTACTACAT AGG (reversed) | Intergenic | ||
No off target data available for this crispr |