ID: 1189907498

View in Genome Browser
Species Human (GRCh38)
Location X:45776686-45776708
Sequence CAGCATCTATCGCAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189907489_1189907498 5 Left 1189907489 X:45776658-45776680 CCCAAACCCAATTTTGTCACATC No data
Right 1189907498 X:45776686-45776708 CAGCATCTATCGCAAGGGGCTGG No data
1189907492_1189907498 -2 Left 1189907492 X:45776665-45776687 CCAATTTTGTCACATCCTGACCA No data
Right 1189907498 X:45776686-45776708 CAGCATCTATCGCAAGGGGCTGG No data
1189907491_1189907498 -1 Left 1189907491 X:45776664-45776686 CCCAATTTTGTCACATCCTGACC No data
Right 1189907498 X:45776686-45776708 CAGCATCTATCGCAAGGGGCTGG No data
1189907488_1189907498 27 Left 1189907488 X:45776636-45776658 CCTATGTAGTAGAAATAATACTC No data
Right 1189907498 X:45776686-45776708 CAGCATCTATCGCAAGGGGCTGG No data
1189907490_1189907498 4 Left 1189907490 X:45776659-45776681 CCAAACCCAATTTTGTCACATCC No data
Right 1189907498 X:45776686-45776708 CAGCATCTATCGCAAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189907498 Original CRISPR CAGCATCTATCGCAAGGGGC TGG Intergenic
No off target data available for this crispr