ID: 1189910264

View in Genome Browser
Species Human (GRCh38)
Location X:45804144-45804166
Sequence TTGACAGAAACCATAGACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189910264_1189910269 26 Left 1189910264 X:45804144-45804166 CCCTAGTCTATGGTTTCTGTCAA No data
Right 1189910269 X:45804193-45804215 CTGGAAACTATGGCCTGTGTTGG No data
1189910264_1189910267 16 Left 1189910264 X:45804144-45804166 CCCTAGTCTATGGTTTCTGTCAA No data
Right 1189910267 X:45804183-45804205 AAAAATGATCCTGGAAACTATGG No data
1189910264_1189910266 7 Left 1189910264 X:45804144-45804166 CCCTAGTCTATGGTTTCTGTCAA No data
Right 1189910266 X:45804174-45804196 TAAGAAATGAAAAATGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189910264 Original CRISPR TTGACAGAAACCATAGACTA GGG (reversed) Intergenic
No off target data available for this crispr