ID: 1189910265

View in Genome Browser
Species Human (GRCh38)
Location X:45804145-45804167
Sequence ATTGACAGAAACCATAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189910265_1189910269 25 Left 1189910265 X:45804145-45804167 CCTAGTCTATGGTTTCTGTCAAT No data
Right 1189910269 X:45804193-45804215 CTGGAAACTATGGCCTGTGTTGG No data
1189910265_1189910266 6 Left 1189910265 X:45804145-45804167 CCTAGTCTATGGTTTCTGTCAAT No data
Right 1189910266 X:45804174-45804196 TAAGAAATGAAAAATGATCCTGG No data
1189910265_1189910267 15 Left 1189910265 X:45804145-45804167 CCTAGTCTATGGTTTCTGTCAAT No data
Right 1189910267 X:45804183-45804205 AAAAATGATCCTGGAAACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189910265 Original CRISPR ATTGACAGAAACCATAGACT AGG (reversed) Intergenic
No off target data available for this crispr