ID: 1189911152

View in Genome Browser
Species Human (GRCh38)
Location X:45811557-45811579
Sequence ATAAAGGCACAGATGTAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189911152_1189911156 29 Left 1189911152 X:45811557-45811579 CCTAGCTACATCTGTGCCTTTAT No data
Right 1189911156 X:45811609-45811631 CAACAACCACTACAACCCTCAGG No data
1189911152_1189911153 -10 Left 1189911152 X:45811557-45811579 CCTAGCTACATCTGTGCCTTTAT No data
Right 1189911153 X:45811570-45811592 GTGCCTTTATCACTCAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189911152 Original CRISPR ATAAAGGCACAGATGTAGCT AGG (reversed) Intergenic
No off target data available for this crispr