ID: 1189912450

View in Genome Browser
Species Human (GRCh38)
Location X:45824727-45824749
Sequence GGTGGGCTGTGAGCCCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189912450_1189912463 16 Left 1189912450 X:45824727-45824749 CCATGAAGGGCTCACAGCCCACC No data
Right 1189912463 X:45824766-45824788 GGGAAGGAAGAGCCTAAGGTTGG No data
1189912450_1189912456 -4 Left 1189912450 X:45824727-45824749 CCATGAAGGGCTCACAGCCCACC No data
Right 1189912456 X:45824746-45824768 CACCACAAGGCGGCACCCCAGGG No data
1189912450_1189912461 12 Left 1189912450 X:45824727-45824749 CCATGAAGGGCTCACAGCCCACC No data
Right 1189912461 X:45824762-45824784 CCCAGGGAAGGAAGAGCCTAAGG No data
1189912450_1189912455 -5 Left 1189912450 X:45824727-45824749 CCATGAAGGGCTCACAGCCCACC No data
Right 1189912455 X:45824745-45824767 CCACCACAAGGCGGCACCCCAGG No data
1189912450_1189912458 0 Left 1189912450 X:45824727-45824749 CCATGAAGGGCTCACAGCCCACC No data
Right 1189912458 X:45824750-45824772 ACAAGGCGGCACCCCAGGGAAGG No data
1189912450_1189912464 20 Left 1189912450 X:45824727-45824749 CCATGAAGGGCTCACAGCCCACC No data
Right 1189912464 X:45824770-45824792 AGGAAGAGCCTAAGGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189912450 Original CRISPR GGTGGGCTGTGAGCCCTTCA TGG (reversed) Intergenic
No off target data available for this crispr