ID: 1189913402

View in Genome Browser
Species Human (GRCh38)
Location X:45834022-45834044
Sequence TTGAATATGCAGATGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189913397_1189913402 9 Left 1189913397 X:45833990-45834012 CCAAGTACAGAAAACCCCACAAT No data
Right 1189913402 X:45834022-45834044 TTGAATATGCAGATGGTCCATGG No data
1189913400_1189913402 -7 Left 1189913400 X:45834006-45834028 CCACAATAACATAAACTTGAATA No data
Right 1189913402 X:45834022-45834044 TTGAATATGCAGATGGTCCATGG No data
1189913398_1189913402 -5 Left 1189913398 X:45834004-45834026 CCCCACAATAACATAAACTTGAA No data
Right 1189913402 X:45834022-45834044 TTGAATATGCAGATGGTCCATGG No data
1189913399_1189913402 -6 Left 1189913399 X:45834005-45834027 CCCACAATAACATAAACTTGAAT No data
Right 1189913402 X:45834022-45834044 TTGAATATGCAGATGGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189913402 Original CRISPR TTGAATATGCAGATGGTCCA TGG Intergenic
No off target data available for this crispr