ID: 1189915378

View in Genome Browser
Species Human (GRCh38)
Location X:45851190-45851212
Sequence GCGCTTCTGCGCGCGCGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189915378_1189915386 15 Left 1189915378 X:45851190-45851212 CCACAGCGCGCGCGCAGAAGCGC No data
Right 1189915386 X:45851228-45851250 GTGCACCTTCCTTCTGCCCCTGG No data
1189915378_1189915381 -10 Left 1189915378 X:45851190-45851212 CCACAGCGCGCGCGCAGAAGCGC No data
Right 1189915381 X:45851203-45851225 GCAGAAGCGCGCCCACCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189915378 Original CRISPR GCGCTTCTGCGCGCGCGCTG TGG (reversed) Intergenic
No off target data available for this crispr