ID: 1189919989

View in Genome Browser
Species Human (GRCh38)
Location X:45894167-45894189
Sequence GTAACATAGTTGAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189919989_1189919992 -2 Left 1189919989 X:45894167-45894189 CCCATATCACTCAACTATGTTAC No data
Right 1189919992 X:45894188-45894210 ACCTGCTTAGCCTCTGAGGAAGG No data
1189919989_1189919994 1 Left 1189919989 X:45894167-45894189 CCCATATCACTCAACTATGTTAC No data
Right 1189919994 X:45894191-45894213 TGCTTAGCCTCTGAGGAAGGTGG No data
1189919989_1189919996 10 Left 1189919989 X:45894167-45894189 CCCATATCACTCAACTATGTTAC No data
Right 1189919996 X:45894200-45894222 TCTGAGGAAGGTGGTCTGTAAGG No data
1189919989_1189919991 -6 Left 1189919989 X:45894167-45894189 CCCATATCACTCAACTATGTTAC No data
Right 1189919991 X:45894184-45894206 TGTTACCTGCTTAGCCTCTGAGG No data
1189919989_1189919997 19 Left 1189919989 X:45894167-45894189 CCCATATCACTCAACTATGTTAC No data
Right 1189919997 X:45894209-45894231 GGTGGTCTGTAAGGTTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189919989 Original CRISPR GTAACATAGTTGAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr