ID: 1189927238

View in Genome Browser
Species Human (GRCh38)
Location X:45969125-45969147
Sequence TCATTCCTATTTTTTTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189927238_1189927242 18 Left 1189927238 X:45969125-45969147 CCATCTCAAAAAAATAGGAATGA No data
Right 1189927242 X:45969166-45969188 ACTCATTCCTACAGGAATCCTGG No data
1189927238_1189927241 10 Left 1189927238 X:45969125-45969147 CCATCTCAAAAAAATAGGAATGA No data
Right 1189927241 X:45969158-45969180 GTACTCATACTCATTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189927238 Original CRISPR TCATTCCTATTTTTTTGAGA TGG (reversed) Intergenic
No off target data available for this crispr