ID: 1189927241

View in Genome Browser
Species Human (GRCh38)
Location X:45969158-45969180
Sequence GTACTCATACTCATTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189927238_1189927241 10 Left 1189927238 X:45969125-45969147 CCATCTCAAAAAAATAGGAATGA No data
Right 1189927241 X:45969158-45969180 GTACTCATACTCATTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189927241 Original CRISPR GTACTCATACTCATTCCTAC AGG Intergenic
No off target data available for this crispr