ID: 1189942420

View in Genome Browser
Species Human (GRCh38)
Location X:46138480-46138502
Sequence CAGGACAAGGTCAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189942420_1189942430 20 Left 1189942420 X:46138480-46138502 CCTGCCTCCTTGACCTTGTCCTG No data
Right 1189942430 X:46138523-46138545 GTTCCAAAGGGGCATTACCCTGG No data
1189942420_1189942429 9 Left 1189942420 X:46138480-46138502 CCTGCCTCCTTGACCTTGTCCTG No data
Right 1189942429 X:46138512-46138534 AGACTTACATAGTTCCAAAGGGG No data
1189942420_1189942427 7 Left 1189942420 X:46138480-46138502 CCTGCCTCCTTGACCTTGTCCTG No data
Right 1189942427 X:46138510-46138532 AGAGACTTACATAGTTCCAAAGG No data
1189942420_1189942432 28 Left 1189942420 X:46138480-46138502 CCTGCCTCCTTGACCTTGTCCTG No data
Right 1189942432 X:46138531-46138553 GGGGCATTACCCTGGCCACTTGG No data
1189942420_1189942428 8 Left 1189942420 X:46138480-46138502 CCTGCCTCCTTGACCTTGTCCTG No data
Right 1189942428 X:46138511-46138533 GAGACTTACATAGTTCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189942420 Original CRISPR CAGGACAAGGTCAAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr