ID: 1189943259

View in Genome Browser
Species Human (GRCh38)
Location X:46150279-46150301
Sequence AGGTTTTTATAGACAGCGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189943256_1189943259 13 Left 1189943256 X:46150243-46150265 CCCATACAATTTACATCTATCAA No data
Right 1189943259 X:46150279-46150301 AGGTTTTTATAGACAGCGTATGG No data
1189943257_1189943259 12 Left 1189943257 X:46150244-46150266 CCATACAATTTACATCTATCAAT No data
Right 1189943259 X:46150279-46150301 AGGTTTTTATAGACAGCGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189943259 Original CRISPR AGGTTTTTATAGACAGCGTA TGG Intergenic
No off target data available for this crispr