ID: 1189951052

View in Genome Browser
Species Human (GRCh38)
Location X:46231215-46231237
Sequence AGAGATGACACACTCAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189951052_1189951062 28 Left 1189951052 X:46231215-46231237 CCTAATTTGAGTGTGTCATCTCT No data
Right 1189951062 X:46231266-46231288 CATTATTCAATGATGGAGGTGGG No data
1189951052_1189951059 21 Left 1189951052 X:46231215-46231237 CCTAATTTGAGTGTGTCATCTCT No data
Right 1189951059 X:46231259-46231281 ATACACACATTATTCAATGATGG No data
1189951052_1189951061 27 Left 1189951052 X:46231215-46231237 CCTAATTTGAGTGTGTCATCTCT No data
Right 1189951061 X:46231265-46231287 ACATTATTCAATGATGGAGGTGG No data
1189951052_1189951060 24 Left 1189951052 X:46231215-46231237 CCTAATTTGAGTGTGTCATCTCT No data
Right 1189951060 X:46231262-46231284 CACACATTATTCAATGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189951052 Original CRISPR AGAGATGACACACTCAAATT AGG (reversed) Intergenic
No off target data available for this crispr