ID: 1189951056

View in Genome Browser
Species Human (GRCh38)
Location X:46231243-46231265
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189951056_1189951063 23 Left 1189951056 X:46231243-46231265 CCTGGGACCCTAACTGATACACA No data
Right 1189951063 X:46231289-46231311 ATTGAAGTCCAGACCTAGTCTGG No data
1189951056_1189951061 -1 Left 1189951056 X:46231243-46231265 CCTGGGACCCTAACTGATACACA No data
Right 1189951061 X:46231265-46231287 ACATTATTCAATGATGGAGGTGG No data
1189951056_1189951060 -4 Left 1189951056 X:46231243-46231265 CCTGGGACCCTAACTGATACACA No data
Right 1189951060 X:46231262-46231284 CACACATTATTCAATGATGGAGG No data
1189951056_1189951059 -7 Left 1189951056 X:46231243-46231265 CCTGGGACCCTAACTGATACACA No data
Right 1189951059 X:46231259-46231281 ATACACACATTATTCAATGATGG No data
1189951056_1189951062 0 Left 1189951056 X:46231243-46231265 CCTGGGACCCTAACTGATACACA No data
Right 1189951062 X:46231266-46231288 CATTATTCAATGATGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189951056 Original CRISPR TGTGTATCAGTTAGGGTCCC AGG (reversed) Intergenic
No off target data available for this crispr