ID: 1189951058

View in Genome Browser
Species Human (GRCh38)
Location X:46231251-46231273
Sequence GAATAATGTGTGTATCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189951058_1189951063 15 Left 1189951058 X:46231251-46231273 CCTAACTGATACACACATTATTC No data
Right 1189951063 X:46231289-46231311 ATTGAAGTCCAGACCTAGTCTGG No data
1189951058_1189951062 -8 Left 1189951058 X:46231251-46231273 CCTAACTGATACACACATTATTC No data
Right 1189951062 X:46231266-46231288 CATTATTCAATGATGGAGGTGGG No data
1189951058_1189951061 -9 Left 1189951058 X:46231251-46231273 CCTAACTGATACACACATTATTC No data
Right 1189951061 X:46231265-46231287 ACATTATTCAATGATGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189951058 Original CRISPR GAATAATGTGTGTATCAGTT AGG (reversed) Intergenic
No off target data available for this crispr