ID: 1189951060

View in Genome Browser
Species Human (GRCh38)
Location X:46231262-46231284
Sequence CACACATTATTCAATGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189951056_1189951060 -4 Left 1189951056 X:46231243-46231265 CCTGGGACCCTAACTGATACACA No data
Right 1189951060 X:46231262-46231284 CACACATTATTCAATGATGGAGG No data
1189951052_1189951060 24 Left 1189951052 X:46231215-46231237 CCTAATTTGAGTGTGTCATCTCT No data
Right 1189951060 X:46231262-46231284 CACACATTATTCAATGATGGAGG No data
1189951055_1189951060 -1 Left 1189951055 X:46231240-46231262 CCTCCTGGGACCCTAACTGATAC No data
Right 1189951060 X:46231262-46231284 CACACATTATTCAATGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189951060 Original CRISPR CACACATTATTCAATGATGG AGG Intergenic
No off target data available for this crispr