ID: 1189951061

View in Genome Browser
Species Human (GRCh38)
Location X:46231265-46231287
Sequence ACATTATTCAATGATGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189951057_1189951061 -8 Left 1189951057 X:46231250-46231272 CCCTAACTGATACACACATTATT No data
Right 1189951061 X:46231265-46231287 ACATTATTCAATGATGGAGGTGG No data
1189951052_1189951061 27 Left 1189951052 X:46231215-46231237 CCTAATTTGAGTGTGTCATCTCT No data
Right 1189951061 X:46231265-46231287 ACATTATTCAATGATGGAGGTGG No data
1189951056_1189951061 -1 Left 1189951056 X:46231243-46231265 CCTGGGACCCTAACTGATACACA No data
Right 1189951061 X:46231265-46231287 ACATTATTCAATGATGGAGGTGG No data
1189951058_1189951061 -9 Left 1189951058 X:46231251-46231273 CCTAACTGATACACACATTATTC No data
Right 1189951061 X:46231265-46231287 ACATTATTCAATGATGGAGGTGG No data
1189951055_1189951061 2 Left 1189951055 X:46231240-46231262 CCTCCTGGGACCCTAACTGATAC No data
Right 1189951061 X:46231265-46231287 ACATTATTCAATGATGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189951061 Original CRISPR ACATTATTCAATGATGGAGG TGG Intergenic
No off target data available for this crispr