ID: 1189953887

View in Genome Browser
Species Human (GRCh38)
Location X:46259091-46259113
Sequence TTGATAAAGAAAAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189953887_1189953890 -6 Left 1189953887 X:46259091-46259113 CCATCTTCCCTTTTCTTTATCAA No data
Right 1189953890 X:46259108-46259130 TATCAACCACGTGTACAGTAAGG No data
1189953887_1189953892 8 Left 1189953887 X:46259091-46259113 CCATCTTCCCTTTTCTTTATCAA No data
Right 1189953892 X:46259122-46259144 ACAGTAAGGAACAGACAACATGG No data
1189953887_1189953894 20 Left 1189953887 X:46259091-46259113 CCATCTTCCCTTTTCTTTATCAA No data
Right 1189953894 X:46259134-46259156 AGACAACATGGCACCGGCCACGG No data
1189953887_1189953893 14 Left 1189953887 X:46259091-46259113 CCATCTTCCCTTTTCTTTATCAA No data
Right 1189953893 X:46259128-46259150 AGGAACAGACAACATGGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189953887 Original CRISPR TTGATAAAGAAAAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr