ID: 1189954280

View in Genome Browser
Species Human (GRCh38)
Location X:46262003-46262025
Sequence CAGCAAACAGCAGCGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189954268_1189954280 24 Left 1189954268 X:46261956-46261978 CCCTGCCAGATCCGGAGGGATGG No data
Right 1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG No data
1189954270_1189954280 23 Left 1189954270 X:46261957-46261979 CCTGCCAGATCCGGAGGGATGGA No data
Right 1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG No data
1189954271_1189954280 19 Left 1189954271 X:46261961-46261983 CCAGATCCGGAGGGATGGAAGTC No data
Right 1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG No data
1189954273_1189954280 13 Left 1189954273 X:46261967-46261989 CCGGAGGGATGGAAGTCAGCGGT 0: 10
1: 44
2: 108
3: 118
4: 166
Right 1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189954280 Original CRISPR CAGCAAACAGCAGCGGTGGG CGG Intergenic
No off target data available for this crispr