ID: 1189954972

View in Genome Browser
Species Human (GRCh38)
Location X:46268633-46268655
Sequence CTCTACCAGATAGTGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189954972_1189954978 29 Left 1189954972 X:46268633-46268655 CCAAGTTCCACTATCTGGTAGAG No data
Right 1189954978 X:46268685-46268707 AGCGTTCCTACTTCCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189954972 Original CRISPR CTCTACCAGATAGTGGAACT TGG (reversed) Intergenic
No off target data available for this crispr