ID: 1189955408

View in Genome Browser
Species Human (GRCh38)
Location X:46272436-46272458
Sequence CTCTGTGCAAATACCCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189955404_1189955408 26 Left 1189955404 X:46272387-46272409 CCTCATTTTAATTTGGCATGAGT No data
Right 1189955408 X:46272436-46272458 CTCTGTGCAAATACCCTGTAGGG No data
1189955405_1189955408 -2 Left 1189955405 X:46272415-46272437 CCTTCTCTGTACAAAAGCCTACT No data
Right 1189955408 X:46272436-46272458 CTCTGTGCAAATACCCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189955408 Original CRISPR CTCTGTGCAAATACCCTGTA GGG Intergenic
No off target data available for this crispr