ID: 1189960818

View in Genome Browser
Species Human (GRCh38)
Location X:46323387-46323409
Sequence GGACACACTACTCCAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189960818_1189960825 27 Left 1189960818 X:46323387-46323409 CCATCTTTTGGAGTAGTGTGTCC No data
Right 1189960825 X:46323437-46323459 ATTTCATCTTTCCTTTGCAGAGG No data
1189960818_1189960820 -2 Left 1189960818 X:46323387-46323409 CCATCTTTTGGAGTAGTGTGTCC No data
Right 1189960820 X:46323408-46323430 CCTGAACCCCATCGCCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189960818 Original CRISPR GGACACACTACTCCAAAAGA TGG (reversed) Intergenic
No off target data available for this crispr