ID: 1189972073

View in Genome Browser
Species Human (GRCh38)
Location X:46428077-46428099
Sequence GCTCTCTGTAGAATTGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189972069_1189972073 -7 Left 1189972069 X:46428061-46428083 CCATCCCAGCTCCAGAGCTCTCT No data
Right 1189972073 X:46428077-46428099 GCTCTCTGTAGAATTGTCTCAGG No data
1189972064_1189972073 27 Left 1189972064 X:46428027-46428049 CCCACTCTCCTTAATTTGAGACA No data
Right 1189972073 X:46428077-46428099 GCTCTCTGTAGAATTGTCTCAGG No data
1189972066_1189972073 19 Left 1189972066 X:46428035-46428057 CCTTAATTTGAGACAACTCTGAA No data
Right 1189972073 X:46428077-46428099 GCTCTCTGTAGAATTGTCTCAGG No data
1189972065_1189972073 26 Left 1189972065 X:46428028-46428050 CCACTCTCCTTAATTTGAGACAA No data
Right 1189972073 X:46428077-46428099 GCTCTCTGTAGAATTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189972073 Original CRISPR GCTCTCTGTAGAATTGTCTC AGG Intergenic
No off target data available for this crispr