ID: 1189985409

View in Genome Browser
Species Human (GRCh38)
Location X:46549172-46549194
Sequence CTTGAGACACAGAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1189985409_1189985415 27 Left 1189985409 X:46549172-46549194 CCTTTTTCCCTCTGTGTCTCAAG No data
Right 1189985415 X:46549222-46549244 CTGAAATGAAAATGGTATTGTGG No data
1189985409_1189985414 19 Left 1189985409 X:46549172-46549194 CCTTTTTCCCTCTGTGTCTCAAG No data
Right 1189985414 X:46549214-46549236 TTTCTTTTCTGAAATGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1189985409 Original CRISPR CTTGAGACACAGAGGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr